|
Post by Dave on Oct 28, 2021 7:30:34 GMT -5
D" true science address to the Flood of Noah is built upon the Empirical Evidence that is also in agreement with all other branches of science – these hypothesize are then fully open to peer review and invite any and all criticism R" Dave in all fairness to your ideology, science people are not that nice. True science is only interested in presenting the data – and then that data is open for peer reviewD"All I care about is the EMPERICAL EVIDENCE R" Can you listen to Don Patton without getting upset my his so called childish remarks? Can you see the empirical evidence he presents? I did listen to Don Patton – he lied so often and so consistently that even my children laughed at his presentation. If you want to witness to me – do not lie to meD"you just want to take sides and argue – keep people apart R" No I do not wnat to keep people apart or argue Then why do you think it necessary to TAKE SIDES in a battleD"So – you admit it – you fully believe in evolution – but it didn’t start until after the flood How could Adam name all the animals? R" You are impossible at times Dave. Don't you read my writings, or watch my videos? Did you watch John Sanford on Up not down? Apparently not. KINDS are necessary because the ark is too small So creationist say – Noah didn’t t take all the animals God sent to him – he only took otwo ot seven of each KIND Then – after the floods KINDS evolve upwardly to generate all the species we have today Not only did they evolve and change into new and different species – they did it super fast because it all had to happen 6000 years ago Creation science has nothing to do with evolution, we cannot stand the term, and frankly we never use the term. The teaching that a base animal changed in the past - mutated to parent many new unique and different species is evolution – a creature changes its form into an different species God made animals with variety and diversify built into each kind. YEP and afdter the flood a parent of the KIND evolved into all the species of that KINDD"And then all the KINDS evolved upwardly to the current species we have today? R NO, absolutely not. Evolution doesn't exist cannot work and cannot make or create brand new species. So are you suggesting that a Bear evolved downwards into a Raccoon? Or did Raccoons evolve downward into Bears? Or was it a different parent animal that evolved downwardly into Raccoons and Bears?
D"For so long you argued that after Adam things only evolved downwards – only corrupted – only mutated downwards - never upwards R" correct D"Now you argue upward mutation is necessary is necessary to explain all the different species R" I have never said that Dave. So - do you agree with Creationist KINDS or don’t you?D"If you disguise evolution as Theistic Evolution – it is still evolution R" I do not support Theistic Evolution – it is still evolution or any mixing of evolution ideas and creation. Correct – you say God created KINDS and then the KINDS evolved into all the species we have today Sorry – I miss-quote you – you say God created all the KINDS and then the parent KINDS on the ark spoiled downwardly into the all the species we have todaySo is your evolutionary spoiling still happening - are there new and different species continuing to appear today? If not? Why did sin stop spoiling all that DNA?D"All geology – all paleontology – all primatology – all ‘ologies’ – point to one central TRUTH It only happened one way – God’s way R" correct If this is true – why attack the empirical evidence?If this is true - why is it necessary to omit eidence or missrepresent the evidenceD"Creationist KINDS is just another form of theistic evolution R" no it's not. How can you make that idea based on so little study? A Parent creature on the Ark – changed into all the species we have todayD"Absolutely Agree – why can’t Creationist just present the facts R" We do, but the other religion hate God and therefore hate our evidence If that is true – they why do scientist MOCK Ken Hamm?Then show me Ken Hamms FACTsInstead - all you have done is offer opinions from other CreationistD"There is no chance I will accept any type of evolution – no matter how you disguise it R" you are bias before you study my videos? I do not present any other type of evolution... Pre-programmed code switched off and than switched on, if and when required, is nothing evolutionary... Do you even understand what evolution means on a biological scale?Yep = Natural selection and then the species change into a new species – the very definition od evolution!Pre-programmed code switched off and than switched on, if and when required, is nothing evolutionary...Is the deffinition of evolution - upward change through natural selectionTo say - things changed when God required it = Theistic Evolution (Evolution at God direction) Creation = God said and it was - each species one at a time - God said and it was = CREATION“She is of the opinion that the bread and butter of the ICR = seriously altering – or outright changing definitions – in order to reestablish their own narrative”This is also the Robert Method - switch your words around then repeat it back incorrectly just to argue against his own version - I have always told Robert this You say there is no such thing as evolution – the parent of a genus changed into / grew into / or spoiled into all the species within that genus It is nothing more than another Robert word game
|
|
|
Post by Dave on Oct 29, 2021 10:39:55 GMT -5
1- In Fairness – The creationist claim of KINDS is necessary because the Ark is too small to fit all of their claims. 1- They are trapped by a false assumption – a cubit =18” 2- This is a post-flood Egyptian measurement 3- Noah used a pre-flood measurement – zero proof they are equal POINT – the Ark may have been a little larger, or a lot larger, or much smaller POINT – the size of the Ark is an assumption – NOT FACT The Revelation about the dimensions of the Ark = the 1:6 ratio Which is the absolute most stable platform for large ships - not rediscovered by man until the 19th century - when ships again began to grow to this sizePOINT – who and what was on the ArkGen 6:17 Now I am about to bring the flood—water upon the land—to destroy all flesh in which is the spirit of life from under the sky. Everything that is on the land will perish. Gen 6:17 And, behold, I, even I, do bring a flood of waters upon the earth, to destroy all flesh, wherein is the breath of life, from under heaven; and every thing that is in the earth shall die. to destroy all flesh in which is the spirit of life- Ruach chayto destroy all flesh, wherein is the breath of life, - Ruach chayRobert demands this can only mean (HS) Robert demands that mankind – (HS)+(Biology) – HS empowered animals Robert demands this is not animals – they are (nepesh)+(biology)
Roberts version – all the animals were not destroyed in the flood – only mankindTruth - in a way I agree - not all life was destroyed in the Flood - the intened target was those who have been corrupted by the "SPIRIT of the archon - bane elohiym - Nephilim + Chimeras"Truth – all animals were not destroyed by the Flood – Fish? Whales? Sharks? Insects? Amphibians? Reptiles? Fowl? – NO – many of these creatures survive nature all the time. Of this group only Whales and Dolphins (group) have live births in water – the rest are egg layers. Truth did dinos walk with man – yes before the FloodThe Flood event that changed planet earth also destroyed the last dinos No – dinos on the Ark Creationist claim of dinos on the Ark only make the size issue worse for themGen 6:20 Of fowls after their kind, and of cattle after their kind, of every creeping thing of the earth after his kind, two of every sort shall come unto thee, to keep them alive. Gen 6:20 Of the flying creatures according to their kind, of the livestock according to their kind, of all the crawling creatures of the ground according to their kind—two of everything will come to you to keep them alive. POINT – scripture does not say every species possible – it says every specie God sent to Noah Creationist claim of 2 of every species on the Ark only make the size issue worse for them 2- In fairness – Creationist do not say The Base KIND evolved into all the KINDS of their KIND They suggest that the base KIND – hybrid with itself to make all the hybrids of that KIND So they pretend NOT to suggest upward mutation – only lateral mutationsIf this is true – why do Creationist deny the empirical evidenceThe Empirical Evidence does suggest family trees – and open science has published very STRICT guidelines to follow in making their taxonomy trees. Why don’t the two agree? And why is wont Creationist publish their guidelines? And if this happened after the Flood:Why can’t this happen before the Flood:When the Empirical Evidence of the fossil record says:H4327 – מִין - mı̂yn - From an unused root meaning to portion out; a sort, that is, species: - kind. Roman Edit – according to you this cannot mean end product species – but parent genusOr does it means end product species as in Incremental Creation?Let’s discuss the HEAT PROBLEM49:50 – THE HEAT PROBLEM – YES! – Everything she says here is right on the money Where did the energy go – what happens to the energy when you speed up the time Her later argument about Rapid Decay heat/energy displacement is amazing Where did the energy come from in the first place to create the flood? Then – where did the energy/heat go that was produced in the process? Energy cannot be created or destroyed – only translated or transmuted! Answer – the “Potential Energy” came from the pressures and gravity well of a Jupiter sized gas giant Proto-planet Once the atm is removed this “Potential Energy” is released in the form of DECOMPRESSION The “Kinetic Energy” release (HEAT) fuels the decompression sequence – and still provides the mechanism for plate tectonics, volcanology, earth quakes, sea mounts, and secondary decompression cracks + about 50 other sciences 53:15- keep the heat problem in the back of your mind because it is relevant to all other sciences
|
|
Deleted
Deleted Member
Posts: 0
|
Post by Deleted on Oct 29, 2021 15:53:23 GMT -5
D" The teaching that a base animal changed in the past - mutated to parent many new unique and different species is evolution – a creature changes its form into an different species
God made animals with variety and diversify built into each kind. YEP and afdter the flood a parent of the KIND evolved into all the species of that KIND
R" do you have any idea what evolution is? CCGTAGCTGGTACTATACCGACTGCTGCAACTAAGC This is a pile of letters of information on the DNA strand. Evolution is the process of changing this information into something brand new and of meaningful advantage for the organism. Suppose this strand is the protein for a nose.... The protein code begins from TATA, hence here is the protein codon code CCGTAGCTGGTAC TATACCGACTGCTGCAACTAAGC For different folding and a new nose protein structure the new evolved code must be CCGTAGCTGGTAC TATACCGAGAGCTATGACTTTGC etc However this is just the protein structure. Next there must be code changes to the development of this protein in 3D space? What code is this? DO we assume it's the same codon as protein codes, or different reading of the DNA altogether? Nobody knows No body can read the rest of the DNA for decision makings, where to build the new protein, when not to, which road does the new protein travel down on, where not to travel down on, where does the protein get attached, when not to get attached, where is the code for making decisions, None of this additional code has been discovered, and we are talking about trillions of letters of more code, not just the code for proteins. A new structure does not begin with just bricks, bolts, nails and reo. You need further instructions for development. Than you need further brand new code for decision making, looping statements and much much more. Information decisions cannot arise naturally, such a notion is completely absurd. D" So are you suggesting that a Bear evolved downwards into a Raccoon?R" who says the bear and the raccoon are types of the same kind? dogs, dingoes, wolf and the fox, might be. (I say might be) One would have to investigate the genome of the kind genetically. All these animals look more of less like dogs. The panda, the koala and the grizzly are all bears, from the same kind? D" So is your evolutionary spoiling still happening - are there new and different species continuing to appear today? If not?R" I would imagine today too many varieties of DNA inside kinds are being rapidly lost thus not much adaptation is happening today. What animal can't adapt, dies -> instinct. God foreknew the variation for each animal kind as necessary and reprogrammed that change into the genes to be switched on or off as necessary. Our pineal gland function for example is switched off since Adam's sinned? There is no evidence of naturalism gaining brand new information from any natural means, other than a designer designing information, hence evolution on any level does not exist. A divine designer pre-programmed the variations in the DNA to begin with from creation. As animals carried that information, some switched on genes, other switched off some genes, eventually over time, mutations spoiled that code locking the animal into a permanent form we see today. So I doubt many animals have code left for more adaptation change, but some might still. D" why is it necessary to omit eidence or missrepresent the evidenceR" Creation people do not omit evidence or misrepresent the evidence? R" Can you listen to Don Patton without getting upset my his so called childish remarks? Can you see the empirical evidence he presents? I don't think you are willing to listen to anything I present to you.... youtu.be/edkqd9BknJo Dinosaur Figurines, Fact or Fraud Dr. Don Patton goes for an hour, Don presents empirical evidence. ncse.ngo/paluxy-man-creationist-piltdown Evidence against the Paluxy footprints youtu.be/J7F4CGmtQHA Don Patton shows Paluxy evidence, in just 4 minute video. Why do people mock empirical evidence Dave? Please take the time to listen to all the videos. D" KINDS are necessary because the ark is too smallR" No. Average size animals as juveniles is about the same as a sheep. How many sheep like volumes could you fit onto the ark? DO you have any idea? I have seen blurry pictures of the real ark and the replica Ron Wyatt found. The real ark is much bigger say about 1100 metres long, broken in three pieces by glacier ice. D" Not only did they evolve and change into new and different species – they did it super fast because it all had to happen 6000 years agoR" There you go again, use a term that is meaningless " evolve" D" The teaching that a base animal changed in the past -R" who said anything about base animal changing to another base animal? Dogs are dogs, wolves look like dogs, so do foxes and dingoes look like dogs...duh D" the flood a parent of the KIND evolved into all the species of that KINDR" Absolutely NO. not correct. " evolved" no. DO you understand the term you use? Apparently not. D" So are you suggesting that a Bear evolved downwards into a Raccoon?R" not sure about bears and raccoons? Are they the same kind? Wolves, dogs, foxes and dingoes are more or less canine dogs of the dog kind. D" Correct – you say God created KINDS and then the KINDS evolved into all the species we have todayR" Again NO. Do you any any idea what the term "evolved" means ? Apparently no. Not a clue. See my explanation in this post above. The doggy kind changed as programmed to adapt, into other dog features and dog functions. Sadly the mutations and UV radiation spoiled that preprogram code locking some features of dog into species that are nor fixed, so the wolf doesn't sexually mate with the fox anymore, but the wolf and the fox are dogs, of the doggy kind. D" changed into all the species we have todayR" take the different finches we have today? What makes them different species of finches? I do not see why the need to label finch kind birds into dozens of new species. A bigger beak, a small beak, etc, more or less a finch. D" Then show me Ken Hamms FACTs Instead - all you have done is offer opinions from other CreationistR" I already spoke of Ken Ham, back in 1980 I didn't like Ken Ham. I present Creation people I like, is that a problem to you? D" then the species change into a new species R" How does a species change into a new species using natural means Dave? Not possible, unless the code is already fully there for that change. And I wouldn't call it a new species, just a bird of variety. D" It is nothing more than another Robert word gameR" I thought you are a science person? Surely you study biology at the DNA level? Don't you understand my words? Have you viewed any of my videos? Obviously not. I spent over 8 weeks on a forum with Barbarian, a Catholic Christian arguing against evolution in creation. Do you have any serious discussions on what evolution is and means, and I mean at the deepest levels? DNA code we think and assume is based on 4 letters, information technology does not arise from random changes and natural selection of beneficial behaviors, not possible. Your evolved term is a myth. God did not create thousands of species from the beginning of creation. Not necessary. He only needed to create basic kinds and allow the animals to fill and multiple, make new variations based on the genes already in their bodies. For example the canine creature can look like dogs, wolves and foxes and wolverines. But this creature canine is just a canine with variety. Science confuses us with additional meaningless labels. Scripture labels insects with 4 legs, not as we science do with 6, so science has spoiled the labels Scripture uses. Not Scripture's fault, but Science is the cause of confusion. D" Roberts version – all the animals were not destroyed in the flood – only mankindR" No. The breath of life is administrated by the HS in all the animals too. Man is not special as you claim in this theme. Cows and dogs and dinos also have the HS administrating the breath of living in these animals too. D"T ruth - in a way I agree - not all life was destroyed in the FloodR Scripture say all living things died, OK maybe some fish survived, maybe whales did too, maybe insects outside the ark too. We can only speculate the past remember? D" Truth did dinos walk with man – yes before the FloodR" You cannot support this idea and remain true to evolutionary ideas at the same time Dave. You cannot be lukewarm, either hot or cold, not a mixture of truth and error. This is a Bible principle on the notions of science. You cannot add "evolve" into "creation". D" Creationist claim of dinos on the Ark only make the size issue worse for themR" A juvenile dino was the size of a sheep, only a few were larger, how big do you suppose the ark was? Don Patton estimates the ark could house 200 million sheep sized animals, if I remember his video? Would you watch it if I showed you the link? But he assumes the wrong size. If we go on 1100 metres by 200 metres and say 50 metres high, and assume the third was for storage and waste, this is 10 million cubic metres of space. So roughly 6 million metres cube of space for animals, assume each animal takes up 1 cubic metres of space that is space for 3 million land animal pairs. I suggest you watch Don Patton's video, and than triple the estimate he offers. youtu.be/ZIW2c1sxEcASome science estimate 1 million species, but we don't need fish on ark, so we get to just 7,000 land animals. So we have enough space for over 3 million land animal species as well as kinds. And I have only filled the ark 50% or so. D" Creationist do not say The Base KIND evolved into all the KINDS of their KINDR" Why must you hijack God's way and force it mean something else? Science speaks of the Cambrian explosion of animals changing rapidly? This is simply a rapid diversity of animals already programmed to change and adapt. the code for this was already written in the genome. Science re-writes God's way, leaving God out of it, assuming naturalism did it all. This is what you are doing. Natural selection is another hijack of God's way too. I will term this natural adaption, those animals able to cope with changes in their world adapt, those who can't adapt die. A bear walked into Australia and found nothing to eat but gum leaves, so some survived, and the enzymes changed to cope with eating gum leaves. A bear in Asian found only bamboo to eat and survives on bamboo. A bear in Canada find its hard to eat leaves only, so turns more or less on 90% berries and 10% fish, a bit more adaption is required, plus lots of sleeping in winter. Natural adaption is possible as long as the code for that is preserved and still in tact. Science could study the code for this in the grizzly the panda and the koala, find a pair of kolas with Canada bear genes still intact, and slowly over a period of 400 years get the koala to change from Australia to living in Canada. Is this possible? Yes if we do the things I suggest. But science has not yet read anything like the full DNA code, not even 1% of the code is read as yet, we have trillions of code to still find. D"Why don’t the two agree? And why is wont Creationist publish their guidelines?R" Because funding research to disprove evolution would cause hatred in that religion. Why doesn't the Turkey Gov allow us to dig up Noah's ark on the mountain? Because such evidence would end "evolution". D"Where did the energy come from in the first place to create the flood? Then – where did the energy/heat go that was produced in the process? Energy cannot be created or destroyed – only translated or transmuted!R" Conjecture and theories at best Dave. I cannot answer your heat problems. D" keep the heat problem in the back of your mind because it is relevant to all other sciencesR" heat is a byproduct of the work of God, and God does what He wants as He wants. Who is to say God uses naturalism all the time to do His work? That is an assumption. For example a miracle is a process that is supernatural. Shalom
|
|
|
Post by Dave on Oct 30, 2021 0:17:36 GMT -5
D"The teaching that a base animal changed in the past - mutated to parent many new unique and different species is evolution – a creature changes its form into an different species God made animals with variety and diversify built into each kind.YEP and after the flood a parent of the KIND evolved into all the species of that KIND YEP and after the flood a parent of the KIND hybridized laterally into all the species of that KINDR" do you have any idea what evolution is?Evolution the process by which different kinds of living organisms are thought to have developed and diversified from earlier forms during the history of the earth.
(google) What is the best definition of evolution? In biology, evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. ... Evolution relies on there being genetic variation in a population which affects the physical characteristics (phenotype) of an organism.Information decisions cannot arise naturally, such a notion is completely absurd.Evolution relies on there being genetic variation? in a populationD"So are you suggesting that a Bear evolved downwards into a Raccoon? R" who says the bear and the raccoon are types of the same kind?(google) raccoons are part of the order Carnivora. However, an evolutionary tree shows that they are most closely related to bears, sharing a more recent common ancestor with these burly beasts dogs, dingoes, wolf and the fox, might be. (I say might be) One would have to investigate the genome of the kind genetically. All these animals look more of less like dogs.(google) While dogs are domesticated members of the canis genus, foxes belong to several different, non-canis genera (that's the plural form of genus). The twelve most common, “true fox” species belong to the genus vulpesOK – so did dogs hybrid into foxes – or did foxes hybrid into dogsI didn't say evolve - did dogs hybrid into foxes – or did foxes hybrid into dogsThe panda, the koala and the grizzly are all bears, from the same kind?Yes – this is what Creationist say(google) Though koalas are often called "koala bears," they are not bears. In fact, they're not even that closely related. ... Koalas are more closely related to kangaroos and wombatsdid Panda Bears hybrid into Grizzle Bears – or did Grizzle Bears hybrid into Pand BearsOR - are you saying that both Panda Bears and Grizzle Bears both have a common ancestor in the past?Evolution the process by which different kinds of living organisms are thought to have developed and diversified from earlier forms during the history of the earth.God foreknew the variation for each animal kind as necessary and reprogrammed that change into the genes to be switched on or off as necessary. YES! - ... Evolution relies on there being genetic variation in a populationA divine designer pre-programmed the variations in the DNA to begin with from creationYES – the definition of Theistic Evolution Things changed over time as God programmed = Theistic EvolutionThings were created by God – one at a time = CreationD" why is it necessary to omit eidence or missrepresent the evidence R" Creation people do not omit evidence or misrepresent the evidence?Why doesn't the taxonomy tree agree if they all used the same evidence Science make public their taxonomic method - why wont creationist?D"Not only did they evolve and change into new and different species – they did it super fast because it all had to happen 6000 years ago R" There you go again, use a term that is meaningless "evolve"All the KINDS hybrid laterally super-fast because it all had to happen 4500 years agoD"The teaching that a base animal changed in the past - R" who said anything about base animal changing to another base animal? Dogs are dogs, wolves look like dogs, so do foxes and dingoes look like dogs...duhAnd that “KIND” all had a single common ancestor – that branched out (by hybridization) into all the different species we have today Every KIND – all came from a single ancestor - that branched out (by hybridization) into all the different species we have todayD"Then show me Ken Hamms FACTs Instead - all you have done is offer opinions from other Creationist R" I already spoke of Ken Ham, back in 1980 I didn't like Ken Ham.You mean there is more than one type of creationism – creationist don’t even agree Are you saying that in Australia creationist do not teach KINDS?I present Creation people I like, is that a problem to you?And we will get to them – one at a time – your attempt to switch the topic will not workYou say creationism is a science – I say OK lets discuss the facts – and this upsets youD"It is nothing more than another Robert word game R" I thought you are a science person? Surely you study biology at the DNA level? Don't you understand my words? Have you viewed any of my videos? Obviously not.Yep watched it all – Evolution the process by which different kinds of living organisms are thought to have developed and diversified from earlier forms during the history of the earth.
(google) What is the best definition of evolution? In biology, evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. ... Evolution relies on there being genetic variation in a population which affects the physical characteristics (phenotype) of an organism. God foreknew the variation for each animal kind as necessary and reprogrammed that change into the genes to be switched on or off as necessary. YES! - ... Evolution relies on there being genetic variation in a populationDouble Speak – flip flopD"Truth - in a way I agree - not all life was destroyed in the Flood R Scripture say all living things died, OK maybe some fish survived, maybe whales did too, maybe insects outside the ark too. We can only speculate the past remember? R Scripture say all living thing died – except the life that didn’t dieDouble Speak – flip flopD"Truth did dinos walk with man – yes before the Flood R" You cannot support this idea and remain true to evolutionary ideas at the same time Dave.I have no idea what you mean - you write so brieflyObviously you are not familure with who I am - the the dedication of my web-site You cannot be lukewarm, either hot or cold, not a mixture of truth and error. This is a Bible principle on the notions of science. You cannot add "evolve" into "creation".Correct – God say – and it was = creationThere is no such thing as evolution – nothing ever changed it form into a different speciesSome science estimate 1 million species, but we don't need fish on ark, so we get to just 7,000 land animals. So we have enough space for over 3 million land animal species as well as kinds. And I have only filled the ark 50% or so. (google)) About 8.7 million, new estimate says. Summary: About 8.7 million (give or take 1.3 million) is the new, estimated total number of species on Earth -- the most precise calculation ever offered -- with 6.5 million species on land and 2.2 million in oceans
Just mammals – (google) - There are currently 1,258 genera, 156 families, 27 orders, and around 5,937 recognized ... Cetartiodactyla is a large order of hoofed mammals,D"Why don’t the two agree? And why is wont Creationist publish their guidelines? R" Because funding research to disprove evolution would cause hatred in that religion. Why would publishing Creationist guidelines cause hatred?Are you say that the real mission of Creationist is not to educate or engage in peer reviw to expoae the error in other scientist's thinkingD"Where did the energy come from in the first place to create the flood? Then – where did the energy/heat go that was produced in the process? Energy cannot be created or destroyed – only translated or transmuted! R" Conjecture and theories at best Dave. I cannot answer your heat problems.I see – you do not grasp the mechanism involved or the consequences of the creationist view So you cannot even speak to the science – so you just call it conjecture Just as Creationist accuses the scientific community of conspiracyOK - You cannot defend Ken Hamm and the American Creation Institute You say that creationism is taught differently in Australia – you guys have a different Creation story So Post the video of your choice and defend itMake a new Thread - with a clear title If you post Water Veith's 1:00 long video about TIME - I won't bother to answerMaybe one of them will take the time to answer my questionsWhat does Australian Creationist say about KINDS – it must be different than what is presented here.
|
|
|
Post by Dave on Oct 30, 2021 9:30:08 GMT -5
D" D"Where did the energy come from in the first place to create the flood? Then – where did the energy/heat go that was produced in the process? Energy cannot be created or destroyed – only translated or transmuted!R" Conjecture and theories at best Dave. I cannot answer your heat problems. You admit – you do not understand the science – you do not grasp the math But you are arrogant enough – to say all that I stand for is conjecture49:50 – THE HEAT PROBLEM – YES! – Everything she says here is right on the money Where did the energy go – what happens to the energy when you speed up the time Her later argument about Rapid Decay heat/energy displacement is amazing Where did the energy come from in the first place to create the flood? Then – where did the energy/heat go that was produced in the process? Energy cannot be created or destroyed – only translated or transmuted! Answer – the “Potential Energy” came from the pressures and gravity well of a Jupiter sized gas giant Proto-planet Once the atm is removed this “Potential Energy” is released in the form of DECOMPRESSION The “Kinetic Energy” release (HEAT) fuels the decompression sequence – and still provides the mechanism for plate tectonics, volcanology, earth quakes, sea mounts, and secondary decompression cracks + about 50 other sciences 53:15- keep the heat problem in the back of your mind because it is relevant to all other sciences Is this how a true creationist engages in peer review – admit ignorance then revert to name calling Why don’t you spend your efforts discussing the FACTS – instead of trying to discredit the sources?Am I also sponsored by the Free Masons as you claim?I am not the one who says out of one side of their mouths that The Catholic Church is a Jesuit Satanic Cult – but then out of the other side of your mouth you preach - their invited doctrine about satan is the very heart of all your theology
|
|
Deleted
Deleted Member
Posts: 0
|
Post by Deleted on Oct 30, 2021 15:27:57 GMT -5
D"Is this how a true creationist engages in peer review – admit ignorance then revert to name calling
R" Sorry if I offended you Dave. I am just not familiar with this subject.
If this all your interested in, fine. ( I am already versed in your website on expanding earth theories during the Flood, etc).
So me lots of other links to this subject, with both video and text so I can become learned.
Shalom
|
|
|
Post by Dave on Oct 31, 2021 9:30:00 GMT -5
D"Is this how a true creationist engages in peer review – admit ignorance then revert to name calling R" Sorry if I offended you Dave. You’re the one that insisted that the Free Masons are behind scientific theory Do you have any proof – is this a fact – or is this just your attitudeI am just not familiar with this subject.You have been bragging Walter Veith and Don Patton since the beginning You have used them as proof that your version of reality is fact Now you admit – you do not understand what it is you preachSo me lots of other links to this subject, with both video and text so I can become learned.The bulk of scientific discovery is not all listed under one book or video The bulk of scientific discovery comes from 1000s of voices The problem is – you have never met a real creationist before God said – and things appeared – one at a time – individual – over a Biblical 6 day period Natural science has rediscovered the ORDER of creation – and the ORDER agrees 100% with scripture Natural science validated Genesis – why you are not willing to embrace that is beyond comprehension FACT #1 Why Do Genes Suggest Most Men Died Off 7000 Years Ago?https://www.livescience.com › 62754-warring-clans-cau... Jun 6, 2018 — What caused the Y chromosome bottleneck. It just didn’t happen with men – but for all the species Genetic Bottleneck | National Geographic Societyhttps://www.nationalgeographic.org › media › genetic- Mar 8, 2019 — A genetic bottleneck occurs when a population is greatly reduced in size, limiting the genetic diversity of the species. Question – was there an event in the Biblical past that cause a dramatic reduction in species and species type – Answer = YES – the Global Flood of Noah Again – Natural Science validates scripture - why you are not willing to embrace that is beyond comprehension Fact #2Question – is there natural science evidence for a global Flood Answer – Yes www.youtube.com/watch?v=GFUTLXKAaeATurns Out, Earth Was a Water World With No Continents or Land! Mar 8, 2020 - Anton Petrov New book explores Noah’s Flood; says Bible and science can get along August 14, 2012 David Montgomery is a geomorphologist, a geologist who studies changes to topography over time and how geological processes shape landscapes. … the idea that scientific reason and religious faith are somehow at odds with each other “is, in my view, a false dichotomy,” said the University of Washington professor of Earth and space sciences. Day 7 – is a real issue between usGod created everything in 6 Days – then rested on Day 7 (no more creation) Day 7 is still ongoing (Heb 4:1-11) The Flood of Noah happened long after Day 6 closed – but you have new forms of life appearing in the planet 4500 years ago – a lot of species had to come about in a very short time You say this is not new creation – the KINDS were programmed to diversify You say – a Raccoon and a Bear had a common ancestor – after the Flood You say – a horse and a hippo had a common ancestor– after the Flood You say all the monkeys in the world – resulted from a common ancestor– after the Flood You say this is all different than evolution Evolution the process by which different kinds of living organisms are thought to have developed and diversified from earlier forms during the history of the earth.I say – you are just playing a word game A divine designer pre-programmed the variations in the DNA to begin with from creationYES – the definition of Theistic EvolutionSo was Adam designed to die – and it was your Tree of Life that kept him alive All animals were designed to die – but the Tree of Life kept them all alive 3- so when God removed the Tree of Life – man died as he was designed to die So why do you preach everything changed – corrupted – the DNA was altered You do not present a consistent argument During our time together – you actually argue against yourself – this is a perfect exampleD"Truth - in a way I agree - not all life was destroyed in the Flood R Scripture say all living things died, OK maybe some fish survived, maybe whales did too, maybe insects outside the ark too. We can only speculate the past remember?R Scripture say all living thing died – except the life that didn’t dieYou do not present a consistent argument During our time together – you actually argue against yourself – this is a perfect example49:50 – THE HEAT PROBLEM – YES! – Everything she says here is right on the money Where did the energy go – what happens to the energy when you speed up the time Her later argument about Rapid Decay heat/energy displacement is amazing Where did the energy come from in the first place to create the flood? Then – where did the energy/heat go that was produced in the process? Energy cannot be created or destroyed – only translated or transmuted! Answer – the “Potential Energy” came from the pressures and gravity well of a Jupiter sized gas giant Proto-planet Once the atm is removed this “Potential Energy” is released in the form of DECOMPRESSION The “Kinetic Energy” release (HEAT) fuels the decompression sequence – and still provides the mechanism for plate tectonics, volcanology, earth quakes, sea mounts, and secondary decompression cracks + about 50 other sciences 53:15- keep the heat problem in the back of your mind because it is relevant to all other sciences Your suggested answer – God can do anything he wantsDay 7 – is a real issue between us God created everything in 6 Days – then rested on Day 7 (no more creation)The problem is – you have never met a real creationist before God said – and things appeared – one at a time – individual – over a Biblical 6 day period Natural science has rediscovered the ORDER of creation – and the ORDER agrees 100% with scripture Natural science validated Genesis – why you are not willing to embrace that is beyond comprehension
|
|
Deleted
Deleted Member
Posts: 0
|
Post by Deleted on Oct 31, 2021 15:28:03 GMT -5
Dave you are a strange person indeed, you claim to be a real creationist, what that means, only you know. You claim others don't know. You present only one link. You do not define evolution very well. Your lack of links, and evidence is amazing.
OK I watched your one and only video, (you presented this once before)
1:24 "we also believe" (he talks about earth was a globe of ice, than a globe of water, than without any land, maybe a few islands)
R" "we also believe", immediately suggests this evidence is a religious view, the person here has faith in his evidence, and is nothing more than a belief system about the past. (Just the same as mine by the way, a belief system, except mine comes from Scripture)
1:34 "earth theories in the previous videos" also "purple earth"
"approximatelyu 3.5 billion years ago earth was a water world" In north part of Australia, a thermal system that has been preserved for 3 billion years.
"R" purple earth, magma earth, icy earth, water ball earth. billions of years ago, not a clue where the water came from. Somehow evidence that is 3 billion years old still survives even today. This is a belief system, with lots of faith, not the same thing as the Bible speaks of Creation. For example the water came from GOD.
The oxygen 16 came from GOD, not within stars. This person is just another marketed evolutionist, different maybe from mainstream evolutionists, but a different evolutionist, who does not support Creation from Scripture.
And yet, who knows what Dave thinks, he is the true creationist on this forum. And I suspect this video supports his true creationist ideas? 3:07 Earth was a magma ball, and the water vapour was above earth, so all this water vapor came down as rain"
We don't have a theory as to where the water came from? 3:55 earth was a huge water ball for 1 or 2 billion years, we can't answer that precisely right now "it probably looked something like this"
R" Funny how he says we don't know, probably looked like this? This is not a recall of the Creation Account, not a single mention of God.
4:49 looking at oxygen 16, 17 and 18 isotopes. Suggests the rocks have different levels of isotopes. oxygen 16 is made mainly inside stars.
R" Oxygen 16 was created by God, not from inside the stars.
I stopped watching this, as it is nothing more than evolution marketed differently. Got nothing to do with Creation following Scripture.
D"The problem is – you have never met a real creationist before R" Really?
I have watched Jonathon Sarfetti, Robert Gantry, and Don Patton, as well as Ron Wyatt, and Walter Veith. These men are what I call real creationists, and they make lots of videos and discuss lots of evidence from Scripture.
You didn't know about Creation Kinds until I arrived, so you hardly can say you are a true creationist, as you do not know all the Hebrew words of creation.
D"Natural science has rediscovered the ORDER of creation – and the ORDER agrees 100% with scripture
R" You think?
Evolution teaches that the stars formed first than the planets later.
Your video seemed to say the same thing. DO you agree with this order - stars first, than the planets later?
Genesis says earth first, and stars later, different order of things, don't you think?
D"Natural science validated Genesis – why you are not willing to embrace that is beyond comprehension
R" Are you suggesting that all the animal species were created all at once by GOD?
How is that possible unless you invoke the environments of RA to go with those worlds such species require. You are like famous Sir David Frederick Attenborough, who didn't like the parasites of the human eye. So these were created by GOD you say from Edenic times? Sir David Frederick Attenborough would hate you and hate your God for saying that.
So the bears in USA eat salmon and fish and the panda eats bamboo and the koala eats gum leaves. All these worlds were created in Eden?
Your definition of evolution is wanting too:-
Evolution the process by which different kinds of living organisms are thought to have developed and diversified from earlier forms during the history of the earth.
"thought to have" is a religion belief system, not based on science facts at all. "from earlier forms" what does this mean I wonder?
Some www sources of your definition
Evolution is change in the heritable characteristics of biological populations over successive generations. These characteristics are the expressions of genes that are passed on from parent to offspring during reproduction.
in other words the ATCG has to change, and this change of code is passed on during reproduction.
evolution
1. A continuing process of change from one state, condition, or form to another. 2. Change in the genetic composition of a population during successive generations, often resulting in the development of new species. The mechanisms of evolution include natural selection acting on the genetic variation among individuals, mutation, migration, and genetic drift.
meaning 2 is what we are speaking about.
change in the genetic composition within the organism.
In the true creationist view, after the flood, the canine kind goes out and changes to fit the world niches he chooses to live in, there is NO change in the ACTG code, no differences in genetic composition to begin with, only phenotype changes with different canine kinds expressing different phenotype according to the niches they experience, the geneotype remains the same. Over time some of the that ACTG code is lost due to spoiling, from radiation and copying errors, so over time the canine niches are fixed to the world these animals live in. In other words some geneotype is lost, forcing the canine kinds not to relate to one another any more. The fox has no sex with the wolf, etc.
evolution says the code changes, over time more useful code is gained.
creation says the code does not change, over time some code is lost.
evolution says both phenotype and geneotype change over time.
creation says only phenotype changes and geneotype remains the same over time. Eventually some geneotype is lost, so the phenotype is fixed to a species animal.
D"God said – and things appeared – one at a time – individual – over a Biblical 6 day period
R" Did God create the mosquito? Why do males eat pollen, but females suck blood?
So before Adam sinned you have female sucking vampire mozzies flying about? Not the females seeking food for her young since when God cursed the creation, the pollen lack nutrition, so the females only seek nutritious food elsewhere...blood.
Your creation view is all mixed up, you even mix evolution in your creation view. You even play word games, saying I am some theistic evolutionist? I cannot stand the term evolution, and your word games are invented by you and your evolution science people.
So you are saying world famous Jonathon Sarfetti is not a true creationist? How strange of you to say that? And you mock Don Patton who defends the fact man lived with dinos, something you agree with, but you mock Don for presenting something you agree with? I do not follow you.
I would say Dave your problem is , you have never met a real creationist before, one who teaches the earth is just over 6,000 years old. Creation.com teaches this idea.
Shalom
|
|
|
Post by Dave on Nov 1, 2021 2:39:35 GMT -5
Dave you are a strange person indeed, you claim to be a real creationist, what that means, God said a thing – and it appeared = creationYou do not define evolution very well. Your lack of links, and evidence is amazing.Any time you say – two species shared a common ancestor = evolutionCreation = things were created and reproduced only after their own speciesD"The problem is – you have never met a real creationist before R" Really?I miss-spoke – you have met anyone that actually believes in creation without compromise There are many creationist – that are at war with reason and scienceYou didn't know about Creation Kinds until I arrived, so you hardly can say you are a true creationist, as you do not know all the Hebrew words of creation.Why would I know about KINDS hybriding laterally from a common ancestor on the Ark to fill all the species we have todayThere is no such thing as evolution – God said – and created the animal one at a timeD"Natural science has rediscovered the ORDER of creation – and the ORDER agrees 100% with scripture R" You think? - Evolution teaches that the stars formed first than the planets later.Evolution is only concerned with biology – if you are referring to stellar formationStar Formationhttp://abyss.uoregon.edu › ast122 › lectures › lec13 Star formation begins when the denser parts of the cloud core collapse under their own weight/gravity.1- first large gas giants are formed – rocky planetoids at their core 2- they grow so large – they collapse under their own weight (gravity well) Evolution teaches that the stars formed first than the planets later.Is a miss-statement - all stars began as planetoids before hey ignitedCould Jupiter become a star? - BBC Science Focus Magazine In order to turn Jupiter into a star like the Sun, for example, you would have to add about 1,000 times the mass of Jupiter. ... So, Jupiter cannot and will not spontaneously become a star, but if a minimum of 13 extra Jupiter-mass objects happen to collide with it, there is a chance it will. (google) Is Saturn a failed star?Image result for could jupiter become a star Gas giants are also called failed stars because they contain the same basic elements as a star. D"Natural science validated Genesis – why you are not willing to embrace that is beyond comprehension R" Are you suggesting that all the animal species were created all at once by GOD?Nope – one at a time – in Increments Some things on Day one – some things on Day 2 etc Something before breakfast – something in the afternoon – something in the evening Incremental Creation – God enjoyed each Day Your definition of evolution is wanting too:- Evolution the process by which different kinds of living organisms are thought to have developed and diversified from earlier forms during the history of the earth. "from earlier forms" what does this mean I wonder?Any time you say – two species shared a common ancestor = evolution Creation = things were created and reproduced only after their own speciesYou know very well what it means – your pretend ignorance speaks volumes of you seriousnessAny time you say – two species shared a common ancestor = evolution (google) Apes are primates belonging to the superfamily Hominoidea. There are approximately 22 species of apes including gorillas, orangutans, chimpanzees, bonobos, gibbons and humans. Evolution says they all have a common ancestorCreationist say – man stands alone – but all the other species do have a common ancestor that was on the arkCreation says – each one was created by God unique and individual – NO intermediary species The fossil record agrees with creation – not creationistevolution 1. A continuing process of change from one state, condition, or form to another. 2. Change in the genetic composition of a population during successive generations, often resulting in the development of new species. The mechanisms of evolution include natural selection acting on the genetic variation among individuals, mutation, migration, and genetic drift.
meaning 2 is what we are speaking about. change in the genetic composition within the organism.The creationist say – from a single common ancestor on the ark – lateral hybridization resulted in all the species we have today The creationist say – this is accomplished by variation within the genome - genes switching on and off as required The creationist says this was all pre-programmed within the genome God programmed evolution = Theistic Evolution Creation says – each one was created by God unique and individual – NO intermediary species The fossil record agrees with creation – not creationistIn the true creationist view, after the flood, the canine kind goes out and changes to fit the world niches he chooses to live inEvolution calls this Natural Selection D"God said – and things appeared – one at a time – individual – over a Biblical 6 day period R" Did God create the mosquito? Why do males eat pollen, but females suck blood?Yep – and told it to – ‘go forth be fruitful and multiply’females suck blood?Yep – as part of their reproduction cycle to - ‘go forth be fruitful and multiply’So you are saying world famous Jonathon Sarfetti is not a true creationist? How strange of you to say that? And you mock Don Patton who defends the fact man lived with dinos, something you agree with, but you mock Don for presenting something you agree with? I do not follow you. I Mock Don Patton because he is not a truthful presented – just like Ken Hamm or Walter Veith I do not understand why the goal of the Creationist platform is not to educate What is presented – pushed any educated person as far away from scripture as possible What is presented is obvious error to any school child – so what is the Christian witness to a school childI would say Dave your problem is , you have never met a real creationist before, one who teaches the earth is just over 6,000 years old. Creation.com teaches this idea.Yes they do – and it is not supported by scripture or scienceThe first 6 days were not 24hr days as measure by man’s perspective Even your Gerald Schroeder does not support you You mock scripture 2 Pet 3:8 + Psa 19:2 You have been taught to deny Day 7 is ongoing – because you have not been taught Christianity According to you – there is no spirit and no one can enter that Day of rest because it had to over 6000 years ago
|
|
Deleted
Deleted Member
Posts: 0
|
Post by Deleted on Nov 1, 2021 4:21:03 GMT -5
There are a few things I would like you do, to consider for me. DO you have a video of a person who actually more of less (say 90%) presents your view of Creation week as you see it? You mock Walter Veith and Don Patton, OK, I will provide one for you, He follows me around 95% of the same view as I have. He is also Jewish, and NOT SDA. and I like his message. This video was chosen by me because it refutes you millions of yrs idea, your order of creation idea, your homo sapien idea, and your meat eating sharks idea. Please watch the whole video, it goes for 1 hr. youtu.be/k-4dVMtgV2010:46 Sarfetti says time begins 4100 years ago. Not billions of years. is Bible final authority or secular science Hugh Ross, 67 books, ie secular science from nature. 13:29 Acts 17:11 contrasted to Ross idea. 13:54 what does Genesis teach pattern goes against big bang and science teaches earth starts cool and dark/ evolution says earth was light and hot 16:18 problem for evolution because they say star happened first earth is 3 days older than the sun. God made plants to grow without sun, for 3 days. evolution says birds evolve from land creatures, another wrong idea. Order does not match evolution, so time doesn't matter is order is wrong. 18:48 what does day mean? 22:19 is genesis poetry? 24:05 is genesis history? 25:55 how does rest of Scripture interpret Genesis? 32:27 how does Paul in NT see Genesis? 37:55 why death and suffering if God is love? man wrought death into world evolution wrought death into world cannot mix the two 39:02 everything very good why does million of yrs come from? rock layers with fossils, with death and dieases and suffering, is this all very good? bone cancer is very good? don't think so... death is the last enemy... when did fall happen? 42:22 not sure I agree with Sarfetti here? So using Dave's logic everything of Sarfetti is wrong? Just like Schroeder? So obviously Sarfetti is not familar with Ellen White as a prophet, and hence make his own views of when the fall happened? between cains conception and the fall. 45:05 God cursed the ground. Homo sapiens dated to 350,000 yrs ago. Animal death. Gen 1:30 Is 11:6-9 looking back to Eden, animal harmony before SIN ruined it all. (based on Jewish commentary) Plant death... ? When did animals eat meat? before the flood... - not before the fall? Gen 4:7 animals known as predators The Creation magazines are great 54:07 I have many of them. How can we find carbon in diamonds? 57:01 ------------------ D" Creation says – each one was created by God unique and individual – NO intermediary speciesR" nice D" Y ep – and told it to – ‘go forth be fruitful and multiplyR" so the female mozzie was created very good, a blood sucking monster, before Adam sinned? Watch the video please. It refutes this idea. D" Any time you say – two species shared a common ancestor = evolutionR" I am not saying the species are shared by a common ancestor. The fox and the wolf and the dog are canine kinds. The variety is just that variations of the canine kind. I would not call the wolf, fox and dog different species either, as you are assuming evolution already, and it is not. The wolf is exactly the same genotype as the fox as the dog, all they have expressed in different phenotypes. Hence they have no common ancestor. Over time sadly some genotype is lost, so sexually mating the wolf with a fox is not naturally allowed, but in theory could be achieved.D" Evolution calls this Natural SelectionR" No to avoid your terms, simply no. Expressing phenotype over time by the same animals is just that animal suited for that niche since it favours the phenotype. Place the animal in a different environment and the animal would change its phenotype. Is this possible? Dunno in practice, should happen in theory. Has it been tried? Could one find a small brown bear pair, in the USA, and leave it wild in Australia, would it eventually eat gum leaves like koala do, or die? Depends if it has the same geneotype available to do as the koala, but in theory should be possible. Placing a koala bear pair, in the USA in the wild, would it survive? Has anybody tried this? It would prove Creation science, and what I am presenting about the kind phenotype. ---------------- You place a image showing lots of records of human like ancestors? What is this about in your view? Can you explain your view more please? I have a video explaining my view, I agree with it all, except possibly 42:22, when did the fall happen? This video go against some of your ideas, so there are a few areas we disagree on Creation. Overall you are mixing evolution and creation ideas together. Shalom
|
|
|
Post by Dave on Nov 1, 2021 13:58:37 GMT -5
DO you have a video of a person who actually more of less (say 90%) presents your view of Creation week as you see it? Already answered – already postedponderingconfusion.proboards.com/thread/527/creation-vrs-creationist?page=1&scrollTo=6535You mock Walter Veith and Don Patton,I Mock them because they teach error, their goal is not to educatedI do not understnad what is wrong with just the facts and the truthyoutu.be/k-4dVMtgV20 10:46 Sarfetti says time begins 4100 years ago. Not billions of years. is Bible final authority or secular science Time is not linear – you discussion of time is a flawed argument10:45 – he says – science says – the Big Bang Exploded from nothing NO SCIENCE DOES NOT E=mc2 - E is the only thing that existed before the Big Bang! It is a singularity that is omnipotent and omniscient – that cannot be located – beyond our comprehension/understanding11:12 He says Man was created from the beginning – but evolution says man came at the end Literal scripture says – man the biology was created Day 6 – he disagrees with scriptureJews/Gnostics says – man was created Day 1 (as spirit) and then Day 6 (as biology) YES – man was created before Gen 1:26 I have said this all along – you refuse me – not possible you say11:20 – he says – “you have to choose – choose scripture or science they both cannot be right” YES – Creation force you to take sides – stay apart – do not come togetherThe Logarithmic Days of Creation + Incremental Creation only chooses God’s side11:50 – He says – the whole argument comes down to the issue of authority I’m right and you are wrong YES – Creation force you to take sides – stay apart – do not come together12:20 – he set up the argument – is the Bible the final authority – or do we need science to tell us what the Bible says Hugh Ross, 67 books, ie secular science from nature. This is the wrong argument – this is an anti-science bias therefore it is an anti-reason bias Let me explain – this us vrs them attitude1- for centuries the church was the absolute authority on everything 2- 1600 – Copernicus and Galileo – the church held back honest science 3- 1700s – the church held back medicine – NO Autopsies = grave robbers 4- the animosity between science and church was published in a book they changed our attitude Example – 1960 – the Book Baby Bomb – and everyone thought we would over populate to death (google) September 25, 1980, is often cited as the official start of China's one-child policy, (wiki) In 1896, White published A History of the Warfare of Science with Theology in Christendom, the culmination of over thirty years of research and publication on the subject, criticizing what he saw as restrictive, dogmatic forms of Christianity. (google) What is the meaning of conflict thesis? The conflict thesis is a historiographical approach in the history of science that originated in the 19th century with John William Draper and Andrew Dickson White which maintain that there is an intrinsic intellectual conflict between religion and science and that it inevitably leads to hostility To deliberately paint all science and anti-Bible is ERROR To paint scripture as incompatible with science is ERROR It is a 200 year old argument called – ‘Conflict Thesis’ – taken from a secular anti-“Christian” book WAKE UP – it is the 21st Century The introduction of sub-atomic physics – proves beyond any doubt 1- we are made up of tiny little packets of energy that is best described as a wave function All reality is made up of tiny packets of energy All reality is an illusion – is it a hologram? – things are made on non-thing – E=mc2 2- this revelation open the door to multi-dimensionality – other realm of existence (heavens) 3- this very day – there are scientist trying to communicate with an intelligence in another dimension (CERN) 4- this very day – unexplained phenomena like UFOs are described as – intra-dimensional visitations WAKE UP – it is the 21st CenturyTrue Objective Science is validating scripture is every way possibleThe desire to keep the conflict ongoing – only comes from the creationist13:29 Acts 17:11 contrasted to Ross idea. 13:54 what does Genesis teach pattern goes against big bang and science teaches earth starts cool and dark/ evolution says earth was light and hot I have watched and watched this sectionWhere dose Biblical - earth starts cool and dark? – No reference evolution says earth was light and hot – IncorrectScience says there was a long time before light was created 16:18 problem for evolution because they say star happened first earth is 3 days older than the sun. This is a only a problem if you want it to beOur Sun and Moon were set in place in our sky – and the stars that shine upon our land Creationist forget – earth began with a large “firmament” overhead This is just when our sun ignited for us to see – once the Sun is making light we also see the Moon Being able to see the stars now – is simply a function of atm and illumination – we could see through the “firmament” Creationist forget – God made the ALL – all 10 dimension of it and all that is in it One 1 uni-verse = a zillion galaxies with a zillion more stars and plants 16:18 problem for evolution because they say star happened first This is a only a problem if you want it to beGod made plants to grow without sun, for 3 days. Yep – answered many times – The Plant Kingdom came firstevolution says birds evolve from land creatures, another wrong idea.Correct – they are wrong – there is no such thing as evolutionGod said – and they appearedI skipped to this next comment (being honest) 32:27 how does Paul in NT see Genesis? 35:30- Adam is the first “man” not evolved from apes – just as Incremental Creation suggest God – Gen 2:7 = Adam – the first human being 37:10 – Paul expected his audience to already know the theology – the common knowledge of the common man – so that Paul did not have to explain very much YES – the common theology of the time = Jewish theology of the time = a lot more information / knowledge / references than the Roma allowed version – Enoch was in every Temple + and at the Dead Sea 37:55 why death and suffering if God is love? man wrought death into world evolution wrought death into world cannot mix the twoCreationist forget all about Eden Creationist say they stick only to scripture – but where is their Eden? Eden was a sequester locality from the WORLD When Adam and Eve were expelled – Eden did not disappear – access was denied and guarded Adam and Eve left Eden and entered the WORLD If you are Jewish – Eden was not even on this earth – it was heaven 3 a Paradise reserved for the righteous (Enoch) If you are Jewish – Adam and Eve choose to step down into this lower WORLD to witness to it If you are Christian – Adam and Eve were just expelled from Eden into the rest of the WORLD If you are a Creationist – you forget all about Eden 39:02 everything very goodYES – everything was exactly as God designed and then created – all of it the tov and the ra in a delicate balance we call NATURENature that we can look at – anytime and anywhere and see God’s hand in it – Rom 1:19 + Psa 19:2 And the lesson of NATURE – even at the galactic scale – or the microbial scale God creates – life lives – reproduces after it’s ow kind – zero evolution – and life dies – followed by rebirth From the beginning – I am aware – so I am aware I may need to atone – God does tabernacle with man – salvation is only by the Lord – death and Passover, Passover, Passover – then the Harvest/ Pentecost 42:22 not sure I agree with Sarfetti here? The Amish also teach – Cain was fathered after the fall because sex is dirty But then they also preach – spill no seed on the ground and all have 6 kids Go forth be fruitful and multiple – via sin? So using Dave's logic everything of Sarfetti is wrong?STOP IT – I agreed with a lot of what he said – just not everything Just like Schroeder? STOP IT – I have been told I sound like him 45:05 God cursed the ground. Not as nutritious – an assumption – but OK Homo sapiens dated to 350,000 yrs ago. = a Time argument 45:50 – he set up his argument – “if you are a long ager yo must accept these dating methods”Do I?46:35 - He concludes – science has human death before Adam – you cannot except it Do I?Animal death. Gen 1:30 Is 11:6-9 looking back to Eden, animal harmony before SIN ruined it all. (based on Jewish commentary) YES Robert – Creationist forget all about Eden – where is it – where did it go?Jews say it is a different spiritual location and Christian say it is a different physical location Question – are we talking about Eden – or are we talking about the WORLD – the domain / Kingdom of the Archon since Gen 1:2? Isaiah’s reference is of a future –(wait for it) RESTORATION to what was once was A reference to Eden – not WORLD 48:15 – Adam became a living SOUL (spirit)+(biology)------------------ D" Creation says – each one was created by God unique and individual – NO intermediary species R" nice D" Yep – and told it to – ‘go forth be fruitful and multiply After its own species only – no evolutionD"Any time you say – two species shared a common ancestor = evolution R" I am not saying the species are shared by a common ancestor. The fox and the wolf and the dog are canine kinds. The variety is just that variations of the canine kind. I would not call the wolf, fox and dog different species either, as you are assuming evolution already, and it is not.
The wolf is exactly the same genotype as the fox as the dog, all they have expressed in different phenotypes. Hence they have no common ancestor. Over time sadly some genotype is lost, so sexually mating the wolf with a fox is not naturally allowed, but in theory could be achieved. Sorry Robert – your facts are wrong – your definitions are wrong – therefore your statement here only smacks of ignorance(google) Genetics- 7th Grade Flashcards | QuizletThe phenotype is an organism's physical appearance, and the genotype is the genetic makeup. But your argument is aimed at the genus vrs species level Genus wolf = Canis + 6 species Genus dog = Canis + 6 species + 38 subspecies of Canis lupus Genus fox = Vulpes + 12 species 1 – there are not even the same genus – let alone species 2- yet you say they all had a common ancestor that stepped off the Ark 3- yet you say all these 62 species all had a single common ancestor But you claim it is not evolution (two or more species today have a common ancestor) You claim it is lateral hybridization Horses – is a Quarter Horse a different species than a Thoroughbred Race Horse Answer – NO – they are both hybrids and called BREEDS Cattel have been hybrid for centuries – all of their offspring are cattle Dogs have been hybrid for centuries – all of their offspring are dogs Pigs, sheep, cats have all been hybrid for centuries – all their offspring are pigs, sheep, and cats Corn, rice, wheat, etc hybrid for centuries = more corn, more rice, more wheat You and Creationist say – A common ancestor walked off the ark and (Rapidly) hybrid (not evolved) into at least 62 different species of wolves, dogs, and foxesCreation says – God made the dogs, God made the wolves, and God made the foxes and they all reproduced after their own species/kind---------------- You place a image showing lots of records of human like ancestors? What is this about in your view? Can you explain your view more please? This graph is a reproduction of the “Humanoid Fossil Record” Posted at the Peabody Museum, Museum of natural History, NY, and the Smithsonian primate center Washing DC. I use this – because all the argument about missing links – intermediary species is all focused upon the hominid lineage. Question did man evolved from Apes?Answer – LOOK AT THE EMPERICAL EVIDENCE – NOIndividual species simply appeared in the fossil record Individual species reproduced only after their own KIND/species Some species died out – many actually - but ONE HUMANOID SPECIES SURVIVED the genetic bottleneck, as also described in science As Christians we know this to be the Flood of Noah
|
|
Deleted
Deleted Member
Posts: 0
|
Post by Deleted on Nov 2, 2021 5:11:51 GMT -5
D" Already answered – already posted ponderingconfusion.proboards.com/thread/527/creation-vrs-creationist?page=1&scrollTo=6535R" OK let's look at your Creation theory:- (1) Entropy is inherent to / a by-product of Neg-Entropy /Creation It is not evil – it does not hate – it is only RAR" So this RA you speak of, is not evil nor hatred? Ge 6:5 And GOD saw that the wickedness "Ra" of man was great in the earth, and that every imagination of the thoughts of his heart was only evil "ra" continually. 7 And the LORD said, I will destroy man ...both man, and beast, and the creeping thing, and the fowls of the air; for it repenteth me that I have made them. Why would GOD destroy the creation since RA came over it? If RA is not evil nor hatred? Something wrong with your word meaning, in fact you are playing a word game. Change the meaning to RA, to the fruit of SIN, and the word fits all contexts. But it doesn't if you use your word game meaning. The great flood was sent to destroy mankind doing RA, but you say RA is not evil nor hatred? (2) after their kind, each according to its species ZERO EVOLUTION – no animal ever grew up to be a different speciesR" I do not follow you? Scripture speaks nothing of species, only kinds? SO why are you forcing additional meaning to the Scripture that is not there? You also imply that all the species were created by God? Thus we have the dog, the fox, the wolverine , the wolf, and the dingo, all different species and different animal creatures according to you, but according to me all the same kind, the canine kind. Because you define evolution as changing phenotype, you say animals are not allowed to evolve, so the fox that went onto the ark is the same fox we see today, no changes in phenotype is allowed according to you. (3) Each and every animal existing today – was created one at a time – specificR" SO God created all the species one at a time, specifically. How many species would that be? In one source (https://www.currentresults.com/Environment-Facts/Plants-Animals/estimate-of-worlds-total-number-of-species.php) it is estimated there are 7 million species of plants and animals during Creation. Approximately 80,000 land animals went onto the ark. If the ark Don Patton photographed (obtained illegally on point of death) suggests the ark is 1100m by 50m by 20m making 200,000 cubic metres of volume for animals, 1/3 for waste and 1.3 for storage. Most animals on average consume 1 cubic metre, so there is more than enough for all the species of animals, even if Dave likes this idea. (4) Each and every animal existing today – was created specific – and Adam/man named them allR"Is it possible to name each of the 80,000 animals in a single day? That requires 4 animals ween and watched every second for a total of agonizing 5 hours straight. It is also near impossible for God to speak into existence using words each and every species, 4 species every second for 5 hours. It make sense to create kinds and all the kinds to experience different phenotypes as they need to. The number of animals is far less, and easier to name and enjoy. (5) ZERO EVOLUTION – no animal ever grew up to be a different speciesR" You do not understand evolution. Evolution is the process of changing geneotype which in turn changes the phenotype. Creation is the process of creating all the geneotype the kind requires, and allowing each kind to express different phenotype as that kind requires. Problem is you see the canine phenotypes of the fox, dog, and wolf as different species, when there are not, They are only canine kinds with different phenotype, they all have the same geneotype. (6) V iruses caused harm – they could not help it – if they were to ‘go forth and multiply’ Big fish ate little fish – Carnivores – meat eaters – so much evidence Dinos – many – very many – huge – “Behemoth” Monstrous - sea serpent – fire breathing dragons – “Leviathan”R" Your creation had mozzies sucking blood, meat eating sharks and carnivores from the beginning. You even had viruses doing harm. How is this very good? And why add God's curse after sin, if the creation had RA already? Something wrong with your theory? You have natural death already in Creation and another death for mankind after Adam sinned? Isn't that making things complex? two death processes in Creation, one already from Creation and another one from Adam's sin. (7) You continually call God’s creation flawedR" Well what would you call it? You admit you have RA and negative entropy , a byproduct of God's creation? In my understanding of God's creation is was perfect and a utopia of paradise, all plant eating animals, including the sharks you laugh at me. We have no natural death, only one concept of death until Adam sinned. No animals or plants died before Adam sinned. (8) Dinos – I say God made creation to enjoy it – in all its it beauty – splendor – and mystery I do not have a problem with God – experimenting with creating newer and bigger I do not have an issue with God – allowing Entropy to cause some Dinos to be Monstrous Predictors There is so much evidence for itR" You admit God created negative entropy and experiements with meat eating monsters during Creation. I thought GOD knows everything and thus makes everything perfect, no experiments necessary. (9) Did Dinos walk with man – Yes – there is so much evidence for it – from all around the world Does the empirical evidence support Evolutions time argument – NO Dose the fossil record support the Evolutionist time argument – NOR" so humans lived with dinos. The millions of years of humans on earth is a myth. No millions of years time argument. The fossil record does not support millions of years time argument. Great we both agree, the earth is young, less than 6,500 years old. (10) The Bethe-Weizsacker Formula. R" you postulate a theory allowing the earth to be created by God. " his theory is the fact that it leaves us on a Jupiter like giant gas planet." R" Maybe? Maybe not? Is it necessary to know what GOD did or how God did it? (11) The Biblical Consequences of an Expanding Earth: The Fluid Dynamics of Whole Earth Decompression Theory, David Freed MLS | Mar 28, 2012R" You postulate you own theory of the earth during Creation. (12) The Archon were here first – before the Dinos – and before manI do not have a problem with the archon manipulating dinos - making them angry – causing them to fight Possibly this is why we know them as the serpent raceR" interesting theory, but I am happy to acknowledge it. Is seems OK (13) Also before the Flood you have Gen 6:1-4 The archon (bane elohiym) + the Nephilim + the chimeras 1- they were here first 2- it wasn’t until later – when approx. 200 of them – took human wives 3- they had to change their form to accomplish the deed – they become more ‘flesh’R" You read too much into this. I do not like that God would allow this, mating of different kinds. So we have to agree to disagree here. (14) They fathered the ½ archon + ½ human - demi-gods –R" Interesting theory, we have discussed this archon being much before. (15) But the marriage of archon + human = a mixing of KINDSR" Not possible, this really would invoke evolution on a grand scale. Why must you invoke a mixing of flesh, when the mixing of SIN and transgression is more important to GOD? (16) Question – do Creationist suggest – a Black Bear and a Grizzle Bear got together and had a baby Panda Bear? It is a question? – If it took more than one step – where are the intermediary species?R" you do not understand the notion of phenotype. One day Mr bear had sex with Mrs bear,, and all kinds of phenotype bears came along, some like Panda, some like Koala and some like Grizzly. They all lived in the same place eating the same food as Mr and Mrs Bear. They were after all, all bears. One day some bears wander off far and wide and took their look alike with them, so the phenotype bears became isolated in different worlds. After a time the genotypes got spoiled and locked the phenotype bears into that function. (17) the suggested intermediary forms of man – are simply proof that our species was manipulated a lotR" I would disagree with you. The humanoids are all phenotype humans, nothing more. I have seen living humanoids in PNG, as recently as 1988, many humans look like the humanoids of yesteryear. Dave's video Neal Adams - Science: 01 - Conspiracy: Earth is Growing!Wow, I like that the countries fit when the earth becomes smaller in volume. Neal Adams - Science: 11 - The Pangea Theory: The Big Lie!Interesting video. Thank you for showing these to me. DO you have any on the Creation of Animals by God, videos you would approve of? SHalom
|
|
|
Post by Dave on Nov 2, 2021 6:35:33 GMT -5
Why would GOD destroy the creation since RA came over it? If RA is not evil nor hatred? Something wrong with your word meaning, in fact you are playing a word game. Change the meaning to RA, to the fruit of SIN, and the word fits all contexts. But it doesn't if you use your word game meaning.
I do not have to change word meaning to maintain my theology Ra (movement away from God) Tov (movement toward God) You Jeff Brenner
The great flood was sent to destroy mankind doing RA The Flood was sent to remove the archon and their influence from the earth
(2) after their kind, each according to its species ZERO EVOLUTION – no animal ever grew up to be a different species R" I do not follow you? Scripture speaks nothing of species, only kinds?
H4327 – מִין - mı̂yn - From an unused root meaning to portion out; a sort, that is, species:
מִין ᴵ m.n. 1 kind. 2 species. NH 3 sex. MH 4 gender. [Prob. derived from base מין ᴵ. Related to JAram. מִינָא (= kind, species). Syr. מִינָא (= of s.m.) is a Heb. loan word.] Derivatives: מין ᴵᴵ, מִינִי.
מִין • (min) m (plural indefinite מִינִים, singular construct מִין־, plural construct מִינֵי־) Kind, species, gender, sex, sex (sexual intercourse)
SO why are you forcing additional meaning to the Scripture that is not there? You also imply that all the species were created by God? It is what scripture says =- I accept scripture
Thus we have the dog, the fox, the wolverine , the wolf, and the dingo, all different species and different animal creatures according to you, but according to me all the same kind, the canine kind. You and creation science do not agree with anyone else in the world Science published its taxonomy guidelines – teams of scientists sit around and argue the correct identification of things – their methods are published clearly for anyone to see Why won’t creationist make their scientific method public?
Because you define evolution as changing phenotype, you say animals are not allowed to evolve, so the fox that went onto the ark is the same fox we see today, no changes in phenotype is allowed according to you. Exactly correct!
(3) Each and every animal existing today – was created one at a time – specific R" SO God created all the species one at a time, specifically. How many species would that be? A lot – isn’t God amazing
If the ark Don Patton photographed (obtained illegally on point of death) suggests the ark is 1100m by 50m by 20m making 200,000 cubic metres of volume for animals, 1/3 for waste and 1.3 for storage. Most animals on average consume 1 cubic metre, so there is more than enough for all the species of animals, even if Dave likes this idea.
Gen 6:15 Now this is how you shall make it: the length of the ark 300 cubits, its breadth 50 cubits, and its height 30 cubits.
The construction ratio of the Ark was 1:6 – which is the most stable platform for the open ocean. All large ships today are built to this ration – scripture was 4500 years ahead of ship building science 1100mx50mx20m is a 1:22 ratio – not sea worthy – not scripture Again – Don Patton is NOT scriptural!
(4) Each and every animal existing today – was created specific – and Adam/man named them all R"Is it possible to name each of the 80,000 animals in a single day? That requires 4 animals ween and watched every second for a total of agonizing 5 hours straight. It is also near impossible for God to speak into existence using words each and every species, 4 species every second for 5 hours.
Gen 2:19 Adonai Elohim had formed from the ground every animal of the field and every flying creature of the sky, so He brought them to the man to see what he would call them. Whatever the man called them—each living creature—that was its name. Gen 2:20 So the man gave names to all of the livestock, and to the flying creatures of the sky, and to all the animals of the field; but for the man He did not find a well-matched helper for him.
I accept scripture as written – I do not have to deny any scripture to make my theology fit
(5) ZERO EVOLUTION – no animal ever grew up to be a different species R" You do not understand evolution.
Problem is you see the canine phenotypes of the fox, dog, and wolf as different species, when there are not, They are only canine kinds with different phenotype, they all have the same geneotype. Robber – I have worked in genetics for years – you mix words together to make up ideas
Problem is you see the canine phenotypes of the fox, dog, and wolf as different species, This statement is just gobbelty gook Phenotype – why no two men look alike – some have big noses, some have brown eyes, some are tall, some are short, some are fat Phenotype is why no two foxes are exactly alike – some are bigger, longer tails, different hair color
On the planet today there is only one species of man – but 7.5 billion phenotypes
R" Your creation had mozzies sucking blood, meat eating sharks and carnivores from the beginning. You even had viruses doing harm. How is this very good? Rom 1:19 – Psa 19:2 – intelligent design – amazing balance – only God could have done it Nature witness to God the Creator – not you satan who change all of God’s creation
You have natural death already in Creation and another death for mankind after Adam sinned? Isn't that making things complex? two death processes in Creation, one already from Creation and another one from Adam's sin.
Creationist forget all about Eden Was Eden to totality of all creation – NO Proof – Adam and Eve were ejected from Eden and now must live in the WORLD Hmmm? Amy scriptural parallel there? Rev 12:7-10
After Adam and Eve sinned – there was a war/bustel in Eden and Adam and Eve were cast into the WORLD
(7) You continually call God’s creation flawed R" Well what would you call it? You admit you have RA and negative entropy , a byproduct of God's creation? Rom 1:19 – Psa 19:2 – intelligent design – amazing balance – only God could have done it Nature witness to God the Creator – not your satan who change all of God’s creation
(8) Dinos – I say God made creation to enjoy it – in all its it beauty – splendor – and mystery I do not have a problem with God – experimenting with creating newer and bigger I do not have an issue with God – allowing Entropy to cause some Dinos to be Monstrous Predictors There is so much evidence for it R" You admit God created negative entropy and experiements with meat eating monsters during Creation. I thought GOD knows everything and thus makes everything perfect, no experiments necessary.
(9) Did Dinos walk with man – Yes – there is so much evidence for it – from all around the world Does the empirical evidence support Evolutions time argument – NO Dose the fossil record support the Evolutionist time argument – NO R" so humans lived with dinos. The fossil record does not support millions of years time argument. Great we both agree, the earth is young, less than 6,500 years old. STOP IT – is that an accurate ststement – or are you lying to make a point?
"his theory is the fact that it leaves us on a Jupiter like giant gas planet." R" Maybe? Maybe not? Is it necessary to know what GOD did or how God did it? WHAT THE HELL IS CREATIONISM?
(11) The Biblical Consequences of an Expanding Earth: The Fluid Dynamics of Whole Earth Decompression Theory, David Freed MLS | Mar 28, 2012 R" You postulate you own theory of the earth during Creation. My theory is an addendum to WEDD
(13) Also before the Flood you have Gen 6:1-4 The archon (bane elohiym) + the Nephilim + the chimeras 1- they were here first 2- it wasn’t until later – when approx. 200 of them – took human wives 3- they had to change their form to accomplish the deed – they become more ‘flesh’ R" You read too much into this. I do not like that God would allow this, mating of different kinds. Who cares what you like or don’t like – all I care about is the word of God
(16) Question – do Creationist suggest – a Black Bear and a Grizzle Bear got together and had a baby Panda Bear? It is a question? – If it took more than one step – where are the intermediary species? R" you do not understand the notion of phenotype.
One day Mr bear had sex with Mrs bear,, and all kinds of phenotype bears came along, some like Panda, some like Koala and some like Grizzly. This is absolutely ridicules – show me a real life example of this? And you wonder why a 5 year old laughs at creation science Teaching this in a college will surely cause 1000s to fall on their knees and believe And why I mock creation science – it is not anything close to the scientific method
|
|
Deleted
Deleted Member
Posts: 0
|
Post by Deleted on Nov 2, 2021 14:08:41 GMT -5
M) 2MQ (2MQ MYN) ac: ? co: Kind ab: ? Nm) 2MQ (2MQ MYN) — I. Kind: A category of species. [df: ynm] II. From: [Hebrew and Aramaic; The short form "Q" is used as a prefix meaning "from"] [ms: Nm] [freq. 165] |kjv: kind, among, with, from, since, after, at, by, whether, of, part, before, because, therefore, out, for, than| {str: 4327, 4480, 4481} Jeff Benner.
What does Dave use? H4327 – מִין - mı̂yn - From an unused root meaning to portion out; a sort, that is, species:
מִין ᴵ m.n. 1 kind. 2 species. NH 3 sex. MH 4 gender. [Prob. derived from base מין ᴵ. Related to JAram. מִינָא (= kind, species). Syr. מִינָא (= of s.m.) is a Heb. loan word.] Derivatives: מין ᴵᴵ, מִינִי. You have chosen a man made dictionary meaning over the Hebrew meaning. So does " species" fit all your contexts, yes or no? Ge 1:11 And God said, Let the earth bring forth grass, the herb yielding seed, and the fruit tree yielding fruit after his kind, whose seed is in itself, upon the earth: and it was so. {grass: Heb. tender grass} Ge 1:12 And the earth brought forth grass, and herb yielding seed after his kind, and the tree yielding fruit, whose seed was in itself, after his kind: and God saw that it was good. Ge 1:21 And God created great whales, and every living creature that moveth, which the waters brought forth abundantly, after their kind, and every winged fowl after his kind: and God saw that it was good. Ge 1:24 ¶ And God said, Let the earth bring forth the living creature after his kind, cattle, and creeping thing, and beast of the earth after his kind: and it was so. Ge 1:25 And God made the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and God saw that it was good. Ge 6:20 Of fowls after their kind, and of cattle after their kind, of every creeping thing of the earth after his kind, two of every sort shall come unto thee, to keep them alive. Ge 7:14 They, and every beast after his kind, and all the cattle after their kind, and every creeping thing that creepeth upon the earth after his kind, and every fowl after his kind, every bird of every sort. {sort: Heb. wing} Le 11:14 And the vulture, and the kite after his kind; BINGO. The word meaning does NOT mean SPECIES. Vulture and kite are two different species, but grouped together here as one kind. Le 11:15 Every raven after his kind; Le 11:16 And the owl, and the night hawk, and the cuckow, and the hawk after his kind, BINGO. The word meaning does NOT mean SPECIES. The owl, hawk, cuckoo and other hawks, are many different species, but grouped together here as one kind. Le 11:19 And the stork, the heron after her kind, and the lapwing, and the bat. BINGO. The word meaning does NOT mean SPECIES. the stork and the heron are different species. Le 11:22 Even these of them ye may eat; the locust after his kind, and the bald locust after his kind, and the beetle after his kind, and the grasshopper after his kind. Le 11:29 These also shall be unclean unto you among the creeping things that creep upon the earth; the weasel, and the mouse, and the tortoise after his kind, De 14:13 And the glede, and the kite, and the vulture after his kind, De 14:14 And every raven after his kind, De 14:15 And the owl, and the night hawk, and the cuckow, and the hawk after his kind, De 14:18 And the stork, and the heron after her kind, and the lapwing, and the bat. Eze 47:10 And it shall come to pass, that the fishers shall stand upon it from Engedi even unto Eneglaim; they shall be a place to spread forth nets; their fish shall be according to their kinds, as the fish of the great sea, exceeding many. (KJV) There are several verses that tell you the word miyn can only mean "kind" not "species". You do not follow Scripture at all, nor do you use the line upon line idea. You just pick and choose word game meaning written there by man made dictionaries. D" Why won’t creationist make their scientific method public?R" I wish they would. I wish the SDA had a research facility, and hospitals of their own. Instead we are registered within the world to do things the world does. We even treat cancer using drugs and radiation. Go figure. I am embarrassed to call myself a SDA person in this regard. Even many SDA people have two jabs already. Again I am embarrassed by their silly stand, and pro vaccine attitude. Even Creation Ministries has pro vaccine idiots in the team. I am embarrassed by them too. SO sad, that people do not remain true to Scripture. We are all pulled by the love of the world, as the Scripture says. Twice God tried to make a ELLEN WHITE hospital under God's method of medicine, because Dr Kellogg did it his own way and twice the hospital got burnt down, not the Ellen White way; and thus twice God failed to get his own hospital methods established. So in the end the true ways of Scripture is not available to people. In the USA you have to go to Mexico to receive alternative help in your health. RP" Because you define evolution as changing phenotype, you say animals are not allowed to evolve, so the fox that went onto the ark is the same fox we see today, no changes in phenotype is allowed according to you.D" Exactly correct!R" But you have reduced GOD's ability to program code into animals as something limited and unable to change as He foresaw change coming as a result of Adam sinning, and God cursing creation. If God knew He was going to curse creation due to SIN, than GOD planned for this curse before He created. How did God plan? By writing the geneotype with the ability to express different phenotype within each kind. Such a powerful encoded code can be used to cope with a sinless world or a sinning world, depending upon what Adam does. But you ignore this idea. You even say God cannot create without RA, again limiting GOD to a less powerful God. So here again you admit GOD is less powerful, and cannot create animals with the ability to cope with sin entering the world after Adam sinned and God curses His creation. RP"" SO God created all the species one at a time, specifically. How many species would that be?D" A lot – isn’t God amazingR" You are saying animals are no allowed to express different phenotypes. What about a couple marrying and producing a dark twin and a white twin, two girls at the same birth? How is this possible according to you? (see my link below) How is it that I married my wife and while my eyes are healthy my son's eyes went blind. Different phenotypes from the same geneotypes? Again your model is making no sense at all. My son did not evolve? Nor did my son pick up a disease from our genetics? What we have here is different phenotype, but you refuse to acknowledge this. You say God never intended animals to have sex, so their phenotype expressions can change. Duh? D" 1100mx50mx20m is a 1:22 ratio – not sea worthy – not scriptureR" Oh maybe I got it wrong... 300/6 = 50 . OK where does the 30 cubits come from? So the ark had to be 1200m by 200 m by 120m high? Seems overly big doesn't it? D" I accept scripture as written – I do not have to deny any scripture to make my theology fitR" some answer that is? Is it possible to name each of the 80,000 animals in a single day? That requires 4 animals named and watched every second for a total of agonizing 5 hours straight. Adam must have been busy. D" Phenotype – why no two men look alike – some have big noses, some have brown eyes, some are tall, some are short, some are fat Phenotype is why no two foxes are exactly alike – some are bigger, longer tails, different hair color On the planet today there is only one species of man – but 7.5 billion phenotypesD" This statement is just gobbelty gook
R" exactly that is what you believe? So if there are 7.5 billion human phenotypes, why can't their be millions of canine kind phenotypes? SO the canine kind, has animals of canine that look like foxes, some look like wolves and some like dingoes and some like dogs, all members of canine. All these animals have the same geneotype, but different pheneotype. RP " Your creation had mozzies sucking blood, meat eating sharks and carnivores from the beginning. You even had viruses doing harm. How is this very good?D" Rom 1:19 – Psa 19:2 – intelligent design – amazing balance – only God could have done it Nature witness to God the Creator – not you satan who change all of God’s creationR" So SIN cannot change DAVE"S world (GOD made it with RA) and SIN cannot change the world with RA already in it. God's curse of the world again cannot change the world God created. So SIN does nothing much in your view. D" satan who change all of God’s creationR" Wrong idea. I never said that. We say SIN changed the creation God created. Satan was a sinner just as humans are a sinner. SIN changed the creation, because SIN forces GOD to walk away from SIN, thus cursing the Creation. D" Creationist forget all about Eden Was Eden to totality of all creation – NO Proof – Adam and Eve were ejected from Eden and now must live in the WORLD Hmmm? Amy scriptural parallel there? Rev 12:7-10 After Adam and Eve sinned – there was a war/bustel in Eden and Adam and Eve were cast into the WORLDR" What you saying here is the world outside Eden has meat eating sharks and dino slashing carnivores and natural death and decomposition, while Eden was nice and perfect until Adam sinned, and they got kicked out of the home God made on earth. Instead Adam was a LORD over Creation, and anything that happened to Adam would happen to Creation. Man sinned and immediately all creation began to die ans Adam also immediately began to die. Only one process of death entered the Creation, only when Adam SINNED. Your views are very wrong, with two concepts of death. Scripture calls the concept of death, in two ways, the first death is a sleep, the second death is permanent non-existence. But you, you have natural death as well as these spiritual notions of death, three concepts of death if you will. And natural death occurs before Adam sinned even. No comments on (7) and (8) and (9) you ask me to STOP it RP " Great we both agree, the earth is young, less than 6,500 years old.D" STOP IT – is that an accurate ststement – or are you lying to make a point?R" you said' D" Does the empirical evidence support Evolutions time argument – NOR" therefore earth in not million and billion years old. D" Dose the fossil record support the Evolutionist time argument – NOtherefore animals on earth are not millions of years old I agree with your assessment of words. D" My theory is an addendum to WEDDR" Oh sorry, but in simple laymen terms, you are postulating things about God's creation. D" Who cares what you like or don’t like – all I care about is the word of GodR" Like your word game with myin in the post above, means "species" ? No it doesn't. D" This is absolutely ridicules – show me a real life example of this?R"The best is the picture of twins one black and one white, same parents. thesocietypages.org/socimages/2014/08/01/black-and-white-twins/This remarkable newspaper article illustrates how skin color (which is real) gets translated into categorical racial categories (which are not). The children in the images below — Kian and Remee Hodgson — are fraternal twins born to two bi-racial parents: The story attempts to explain the biology:
Skin colour is believed to be determined by up to seven different genes working together. If a woman is of mixed race, her eggs will usually contain a mixture of genes coding for both black and white skin. Similarly, a man of mixed race will have a variety of different genes in his sperm. When these eggs and sperm come together, they will create a baby of mixed race. But, very occasionally, the egg or sperm might contain genes coding for one skin colour. If both the egg and sperm contain all white genes, the baby will be white. And if both contain just the versions necessary for black skin, the baby will be black.
Fair enough.
But then the journalist makes a logical leap from biological determinants of skin color to racial categories. Referring now to genes for skin color as “black” and “white” genes, she writes: “Baby Kian must have inherited the black genes from both sides of the family, whilst Remee inherited the white ones.” And, of course, while both children are, technically, mixed race*, the headline to the story, “Black and White Twins,” presents them as separate races.
We’re so committed to racial differences that the mother actually speaks about their similarities as if it is surprising that twins of different “races” could possibly have anything in common. She says:
There are some similarities between them. They both love apples and grapes, and their favourite television programme is Teletubbies.”
This is also a nice example of a U.S.-specific racial logic. This might not have been a story in Brazil at all, where racial categories are determined more by color alone and less by who your parents are. It is not uncommon there to have siblings of various racial designations. End quote" SO where does the black and white gene come from? From Adam and Eve. Must have been inside Adam and Eve all along. A natural phenotype expression inside gene Creation Pool. OR maybe the melatin production gene, got spoiled. The gene is switched on too much for some, and switched off too much for others. So the SIN problem spoiled the melatin gene. D" And why I mock creation science – it is not anything close to the scientific methodR" I thought you said you follow Scripture? Shalom
|
|
|
Post by Dave on Nov 2, 2021 15:33:40 GMT -5
M) 2MQ (2MQ MYN) ac: ? co: Kind ab: ? Nm) 2MQ (2MQ MYN) — I. Kind: A category of species.What does Dave use? H4327 – מִין - mı̂yn - From an unused root meaning to portion out; a sort, that is, species: Le 11:14 And the vulture, and the kite after his kind; BINGO. The word meaning does NOT mean SPECIES. Vulture and kite are two different species, but grouped together here as one kind. YEP – vultures after their kind and kites after their kindLe 11:19 And the stork, the heron after her kind, and the lapwing, and the bat. BINGO. The word meaning does NOT mean SPECIES. the stork and the heron are different species. Correct – the stork afte its kind and the heron after its kindYou just pick and choose word game meaning written there by man made dictionaries. I do not have to twist words to support any type of evolution No animal ever grew up to be a completely different animalD"Why won’t creationist make their scientific method public? R" I wish they would. They cannot or suffer embarrassment Creationism does not stand peer reviewRP" Because you define evolution as changing phenotype, you say animals are not allowed to evolve, so the fox that went onto the ark is the same fox we see today, D" Exactly correct!You even say God cannot create without RA, again limiting GOD to a less powerful God Robert – can yo be serious – why must you misrepresent and lie to make creation science trueRP"" SO God created all the species one at a time, specifically. How many species would that be? D" A lot – isn’t God amazing R" You are saying animals are no allowed to express different phenotypes.No I am not – all dogs are not clones of one another – may different types of dogs – and they are all dogsWhat about a couple marrying and producing a dark twin and a white twin, two girls at the same birth? How is this possible according to you? (see my link below) Skin color is an expression of genome Are you suggestion that Black and White are two different species of humanoidswww.bbc.com/news/science-environment-51914782How to argue with a racist: Five myths debunkedMYTH 1: The DNA of white and black people is completely differentInteresting - Ken Hamm is also a racest and has his own science to prove white man is superior and you wonder why creationism is harmfulHow is it that I married my wife and while my eyes are healthy my son's eyes went blind. Different phenotypes from the same geneotypes? Again your model is making no sense at all. My son did not evolve?Nor did his phenotype - See just how ridicules your reasoning is D"I accept scripture as written – I do not have to deny any scripture to make my theology fit R" some answer that is? Is it possible to name each of the 80,000 animals in a single day? TIME – the fall back argument of the desperate So if there are 7.5 billion human phenotypes, why can't their be millions of canine kind phenotypes? I am sure there are – are all dogs just clones of one another – or do they look different If two plants or animals have the exact same phenotype they are clones of one anotherR" What you saying here is the world outside Eden has meat eating sharks and dino slashing carnivores and natural death and decomposition, while Eden was nice and perfect until Adam sinned, and they got kicked out of the home God made on earth. This is what scripture saysInstead Adam was a LORD over Creation, and anything that happened to Adam would happen to Creation. Man sinned and immediately all creation began to die ans Adam also immediately began to die. Only one process of death entered the Creation, only when Adam SINNED. So you say – instead of being kick out od Eden – your Eden just disappeared – your Eden all corruptedGen 3:23 Adonai Elohim sent him away from the Garden of Eden, to work the ground from which he had been taken. Gen 3:24 And He expelled the man; and at the east of the Garden of Eden He had cheruvim dwell along, with the whirling sword of flame, to guard the way to the Tree of Life. If your Eden disappears – if your Eden was corrupted by sinWhy is it guarded so Adam and Eve could not reenter Eden?I do not have to deny any scripture to make my theology correctRP " Great we both agree, the earth is young, less than 6,500 years old. D" STOP IT – is that an accurate statement – or are you lying to make a point? R" you said'Please quote me
|
|